banner mobile bg

Amplicon Sequencing

Amplicon Sequencing cover two major technical directions: short-read and long-read, providing a comprehensive solution for microbial community research.


16S/18S/ITS Amplicon Sequencing is an ultra-deep DNA sequencing method that focuses on sequencing specific target regions (amplicons). Short (<500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR and analyzed by next generation sequencing (NGS) technology, to identify and differentiate multiple microbial species from complicated samples. Amplicon metagenomic sequencing is designated to sequence the target genes of 16S ribosomal RNA (rRNA), or 18S rRNA and Internal Transcribed Spacer (ITS) rRNA by universal primers, to describe and compare the phylogeny and taxonomy of bacteria (and archaea) and fungi (such as yeasts, molds and etc.), respectively.


Full-Length 16S/18S/ITS Amplicon Sequencing is a metagenomic approach that delves deep into the taxonomic composition of complex microbial communities. This sophisticated method amplifies full-length conserved genes, including 16S ribosomal RNA (rRNA), 18S rRNA, and Internal Transcribed Spacer (ITS) rRNA, using PCR techniques. The resulting amplicons are then subjected to high-fidelity, long-read sequencing on the PacBio Revio platform.


How to Choose the Right Amplicon Sequencing Solution:

16S/18S/ITS Amplicon Sequencing (SRS): Illumina

1. A high-throughput and cost-effective solution for profiling microbial communities.

2. Ideal for taxonomic classification and comparative studies across large sample sets.

Full-Length 16S/18S/ITS Amplicon Metagenomic Sequencing (LRS): PacBio

1. Offers strain-level resolution and enhanced precision for microbial community analysis.

2. Best suited for resolving complex microbial ecosystems where higher accuracy is required.

Why Choose Novogene for Your Amplicon Sequencing Needs?

Plentiful Experience
Plentiful Experience

Extensive experience supporting amplicon sequencing projects across diverse research applications.

Cloud Platform-Novomagic
Cloud Platform-Novomagic

Conduct autonomous and rapid analysis at any time and anywhere

Complete solution
Complete solution

Customized production, analysis and solutions for complex samples

Superior Data Quality
Superior Data Quality

Exceeds manufacturer benchmarks, delivering accurate identification and high data purity.

Applications of Amplicon Sequencing in Research and Medicine

Discover the power of amplicon sequencing with Novogene’s services, designed to assist in a variety of research goals:

Cultivation-independent community profiling

Target 16S/18S/ITS regions to identify and classify microbes in complex samples, no culturing required.

Taxonomic marker-based identification

Use conserved gene hypervariable regions for fine-scale microbial classification (phylum to species).

Diversity & abundance analysis

Quantify microbial abundance, richness, evenness, and cross-sample compositional differences.

Novel lineage detection

Uncover unclassified/rare taxa via amplicon-database matching, flagging characterization candidates.

Functional potential inference

Link taxonomic profiles to predicted microbial functions (e.g., metabolism, resistance) via marker genes.

Ecological correlation exploration

Reveal microbial community shifts linked to environmental factors or host phenotypes.

Specifications

Sample Requirements

Sample amounts are listed for reference only. Download the Sample Submission Guidelines to learn more. For detailed information, please contact us with your customized requests.

ServiceSample TypeAmountVolumeConcentrationPurity
Amplicon Metagenomic SequencingTotal DNA≥ 200 ng≥ 40 μL≥ 10 ng/μLOD260/280 = 1.8-2.0,
No degradation, no contamination, no color.
*The recommended concentration of the sample for 16S and 18S is 5–15 ng/ul. The recommended concentration of the sample for ITS is 5–30 ng/ul.
*It is suggested to dilute your samples before submitting them if the sample concentration is too high.
*gDNA for Amplicons Metagenomics should be colorless; otherwise, enzymatic activity will be lower and affect PCR amplification process.
*gDNA for Amplicon Metagenomics should be stored in an EDTA-free buffer (e.g., TB buffer). If EDTA ≥ 0.2 mM, additional purification is recommended.
* DNA should be stored in an EDTA-free buffer (e.g., TB buffer). If EDTA ≥ 0.2 mM, additional purification is recommended.
PacBio Full -Length
16S/18S/ITSTotal DNA≥ 200 ng≥ 40 μL≥ 10 ng/μL

Sequencing and Analysis

Recommended data outputs and analysis contents displayed are for reference only. For detailed information, please contact us with your customized requests.

ServiceAmplicon Metagenomic SequencingPacBio Full -Length 16S/18S/ITS
Sequencing PlatformIllumina NovaSeq SystemPacBio Revio
Sequencing StrategyNovaSeq Reagent (500 Cycles)HiFi Sequencing
Data Output50K/100K/500K raw tags5K/10K/20K/30K/50K/100k clean reads
Qiime1 or Qiime2Standard AnalysisData Quality Control
OTU/ASV Clustering
Taxonomic Annotation
Alpha and Beta Diversity Analyses (UPGMA, PCA, PCoA, NMDS)
Community Differences Analyses (Anosim, MRPP, Adonis, Simper)
Statistical Analyses (T-Test, MetaStat, Wilcoxon test, Kruskal-Wallis Test, LEfSe)
Function Prediction (Qiime2 Only)
Community Assembly Mechanisms( beta NTI, NST, iCAMP)
Standard AnalysisDADA2 denoise, OTU/ASV annotation and relative abundance analysis
Alpha diversity analysis (rarefaction curve, species boxplot)
Beta diversity analysis (heatmap, PCoA, PCA, NMDS)
Comparative analysis between groups and within group (Adonis, Anosim, t-test, Metastat, LDA)
Function prediction
Advanced AnalysisEnvironmental association analysis (Spearman, CCA/RDA, VPA analysis)
Correlation analysis (Network analysis, Network3D)

Primers applied to Amplicon Metagenomic Sequencing

TypesAmplified RegionPacBio RevioPrimersSequences (5’- 3’)
Bacterial 16SV4300 bp515FGTGCCAGCMGCCGCGGTAA
806RGGACTACHVGGGTWTCTAAT
V3-V4470 bp341FCCTAYGGGRBGCASCAG
806RGGACTACNNGGGTATCTAAT
V4-V5450 bp515FGTGCCAGCMGCCGCGGTAA
907RCCGTCAATTCCTTTGAGTTT
V5-V7435 bp799FAACMGGATTAGATACCCKG
1193RACGTCATCCCCACCTTCC
16S (Kinnex V1-V9)~1500 bpFAGRGTTYGATYMTGGCTCAG
RRGYTACCTTGTTACGACTT
Bacterial 16SNovel Archaea V4430 bpArch519FCAGCCGCCGCGGTAA
Arch915RGTGCTCCCCCGCCAATTCCT
Protist 18SV4350 bp528FGCGGTAATTCCAGCTCCAA
706RAATCCRAGAATTTCACCTCT
18S V1-V9~1800 - 2000 bpEuk-AAACCTGGTTGATCCTGCCAGT
Euk-BGATCCTTCTGCAGGTTCACCTAC
Fungal ITSITS1-5F200-400 bpITS5-1737FGGAAGTAAAAGTCGTAACAAGG
ITS2-2043RGCTGCGTTCTTCATCGATGC
ITS2380 bpITS3-2024FGCATCGATGAAGAACGCAGC
ITS4-2409RTCCTCCGCTTATTGATATGC
ITS1-1F200-400 bpITS1FCTTGGTCATTTAGAGGAAGTAA
ITS2GCTGCGTTCTTCATCGATGC
ITS 1-2~500 - 800 bpITS9munngsTACACACCGCCCGTCG
ITS4ngsUniCCTSCSCTTANTDATATGC

Project Workflow

Novogene provides high-quality products and expert services throughout the entire project workflow. Every step is carefully designed and executed to meet rigorous scientific standards, ensuring exceptional research outcomes. To guarantee the accuracy and reliability of sequencing data, stringent quality control (QC) measures are implemented at each stage of the process. The workflow encompasses key steps such as sample preparation and quantification, fragmentation and library preparation, library quality control, sequencing, and bioinformatics analysis.

Project Workflow

Demo Results

Background

Ready to Start Your Project?

Our platform offers tailored solutions for

your unique experimental needs, ensuring a seamless experience from project design to data delivery.